90
|
Metabion International AG
oligonucleotide primers for rat mt-1 (forward 5’- caccgttgctccagattcac -3'; reverse 5'- gcagcagcactgttcgtcac – 3') Oligonucleotide Primers For Rat Mt 1 (Forward 5’ Caccgttgctccagattcac 3'; Reverse 5' Gcagcagcactgttcgtcac – 3'), supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/pm28344072-94-13-44?v=Metabion+International+AG Average 90 stars, based on 1 article reviews
oligonucleotide primers for rat mt-1 (forward 5’- caccgttgctccagattcac -3'; reverse 5'- gcagcagcactgttcgtcac – 3') - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Promega
random oligonucleotide-hexamer primer/moloney murine leukemia virus reverse transcriptase Random Oligonucleotide Hexamer Primer/Moloney Murine Leukemia Virus Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/10__1128_slash_iai__71__3__1569___1573__2003-41-21-28?v=Promega Average 90 stars, based on 1 article reviews
random oligonucleotide-hexamer primer/moloney murine leukemia virus reverse transcriptase - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
oligonucleotide sequences of the forward and reverse rs2204985 specific ngs primers Oligonucleotide Sequences Of The Forward And Reverse Rs2204985 Specific Ngs Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc09532242-107-27-49?v=Metabion+International+AG Average 90 stars, based on 1 article reviews
oligonucleotide sequences of the forward and reverse rs2204985 specific ngs primers - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Sigma-Genosys
the following oligonucleotide primers: forward primer, 5′-ccgctcgtcagactc cagc-3′; and reverse primer, 5′-ctggttatattttca gaaaacatg-3′ The Following Oligonucleotide Primers: Forward Primer, 5′ Ccgctcgtcagactc Cagc 3′; And Reverse Primer, 5′ Ctggttatattttca Gaaaacatg 3′, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/pm20512310-56-30-32?v=Sigma-Genosys Average 90 stars, based on 1 article reviews
the following oligonucleotide primers: forward primer, 5′-ccgctcgtcagactc cagc-3′; and reverse primer, 5′-ctggttatattttca gaaaacatg-3′ - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
specific oligonucleotide primers: forward, 5′-aggagcaaggaggccatatt-3′ and reverse, 5′-aacacaccagcatcctcctc-3′ for nnos Specific Oligonucleotide Primers: Forward, 5′ Aggagcaaggaggccatatt 3′ And Reverse, 5′ Aacacaccagcatcctcctc 3′ For Nnos, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc04732828-56-53-74?v=GenScript+corporation Average 90 stars, based on 1 article reviews
specific oligonucleotide primers: forward, 5′-aggagcaaggaggccatatt-3′ and reverse, 5′-aacacaccagcatcctcctc-3′ for nnos - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
GeneWorks
50 ng of rxfp1 forward and reverse oligonucleotide primers 50 Ng Of Rxfp1 Forward And Reverse Oligonucleotide Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc03448779-160-45-47?v=GeneWorks Average 90 stars, based on 1 article reviews
50 ng of rxfp1 forward and reverse oligonucleotide primers - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
GeNOsys Inc
oligonucleotide primer c-terminal reverse primer spiror Oligonucleotide Primer C Terminal Reverse Primer Spiror, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/pm16968306-62-0-17?v=GeNOsys+Inc Average 90 stars, based on 1 article reviews
oligonucleotide primer c-terminal reverse primer spiror - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Nihon Gene Research Laboratories
oligonucleotide primers and probes for quantitative reverse transcriptase pcr (qrt-pcr) Oligonucleotide Primers And Probes For Quantitative Reverse Transcriptase Pcr (Qrt Pcr), supplied by Nihon Gene Research Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc09689209-33-13-30?v=Nihon+Gene+Research+Laboratories Average 90 stars, based on 1 article reviews
oligonucleotide primers and probes for quantitative reverse transcriptase pcr (qrt-pcr) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
BioTeZ Inc
oligonucleotide mix Oligonucleotide Mix, supplied by BioTeZ Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc05322337-164-43-49?v=BioTeZ+Inc Average 90 stars, based on 1 article reviews
oligonucleotide mix - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
reverse oligonucleotide primer 5"- atcatggcaggtgaggatggact-3 Reverse Oligonucleotide Primer 5" Atcatggcaggtgaggatggact 3, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc06182820-253-28-32?v=Metabion+International+AG Average 90 stars, based on 1 article reviews
reverse oligonucleotide primer 5"- atcatggcaggtgaggatggact-3 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
GeNOsys Inc
oligonucleotide primers for reverse transcription of hprt mrna and subsequent pcr amplification of hprt cdna Oligonucleotide Primers For Reverse Transcription Of Hprt Mrna And Subsequent Pcr Amplification Of Hprt Cdna, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/SNBoANq0q78SVuUxuVATpSwnlr6dvvTYqXuj702DM7hMwWu1gQuVpF3SyIrKZnWfEd2mwW8-55-4-19?v=GeNOsys+Inc Average 90 stars, based on 1 article reviews
oligonucleotide primers for reverse transcription of hprt mrna and subsequent pcr amplification of hprt cdna - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
TranScrip Partners
reverse transcrip-tion using random oligonucleotide primers Reverse Transcrip Tion Using Random Oligonucleotide Primers, supplied by TranScrip Partners, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/pm18777249-24-89-86?v=TranScrip+Partners Average 90 stars, based on 1 article reviews
reverse transcrip-tion using random oligonucleotide primers - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |