reverse oligonucleotide primer Search Results


90
Metabion International AG oligonucleotide primers for rat mt-1 (forward 5’- caccgttgctccagattcac -3'; reverse 5'- gcagcagcactgttcgtcac – 3')
Oligonucleotide Primers For Rat Mt 1 (Forward 5’ Caccgttgctccagattcac 3'; Reverse 5' Gcagcagcactgttcgtcac – 3'), supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/pm28344072-94-13-44?v=Metabion+International+AG
Average 90 stars, based on 1 article reviews
oligonucleotide primers for rat mt-1 (forward 5’- caccgttgctccagattcac -3'; reverse 5'- gcagcagcactgttcgtcac – 3') - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega random oligonucleotide-hexamer primer/moloney murine leukemia virus reverse transcriptase
Random Oligonucleotide Hexamer Primer/Moloney Murine Leukemia Virus Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/10__1128_slash_iai__71__3__1569___1573__2003-41-21-28?v=Promega
Average 90 stars, based on 1 article reviews
random oligonucleotide-hexamer primer/moloney murine leukemia virus reverse transcriptase - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Metabion International AG oligonucleotide sequences of the forward and reverse rs2204985 specific ngs primers
Oligonucleotide Sequences Of The Forward And Reverse Rs2204985 Specific Ngs Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc09532242-107-27-49?v=Metabion+International+AG
Average 90 stars, based on 1 article reviews
oligonucleotide sequences of the forward and reverse rs2204985 specific ngs primers - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Sigma-Genosys the following oligonucleotide primers: forward primer, 5′-ccgctcgtcagactc cagc-3′; and reverse primer, 5′-ctggttatattttca gaaaacatg-3′
The Following Oligonucleotide Primers: Forward Primer, 5′ Ccgctcgtcagactc Cagc 3′; And Reverse Primer, 5′ Ctggttatattttca Gaaaacatg 3′, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/pm20512310-56-30-32?v=Sigma-Genosys
Average 90 stars, based on 1 article reviews
the following oligonucleotide primers: forward primer, 5′-ccgctcgtcagactc cagc-3′; and reverse primer, 5′-ctggttatattttca gaaaacatg-3′ - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GenScript corporation specific oligonucleotide primers: forward, 5′-aggagcaaggaggccatatt-3′ and reverse, 5′-aacacaccagcatcctcctc-3′ for nnos
Specific Oligonucleotide Primers: Forward, 5′ Aggagcaaggaggccatatt 3′ And Reverse, 5′ Aacacaccagcatcctcctc 3′ For Nnos, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc04732828-56-53-74?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
specific oligonucleotide primers: forward, 5′-aggagcaaggaggccatatt-3′ and reverse, 5′-aacacaccagcatcctcctc-3′ for nnos - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GeneWorks 50 ng of rxfp1 forward and reverse oligonucleotide primers
50 Ng Of Rxfp1 Forward And Reverse Oligonucleotide Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc03448779-160-45-47?v=GeneWorks
Average 90 stars, based on 1 article reviews
50 ng of rxfp1 forward and reverse oligonucleotide primers - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GeNOsys Inc oligonucleotide primer c-terminal reverse primer spiror
Oligonucleotide Primer C Terminal Reverse Primer Spiror, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/pm16968306-62-0-17?v=GeNOsys+Inc
Average 90 stars, based on 1 article reviews
oligonucleotide primer c-terminal reverse primer spiror - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Nihon Gene Research Laboratories oligonucleotide primers and probes for quantitative reverse transcriptase pcr (qrt-pcr)
Oligonucleotide Primers And Probes For Quantitative Reverse Transcriptase Pcr (Qrt Pcr), supplied by Nihon Gene Research Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc09689209-33-13-30?v=Nihon+Gene+Research+Laboratories
Average 90 stars, based on 1 article reviews
oligonucleotide primers and probes for quantitative reverse transcriptase pcr (qrt-pcr) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
BioTeZ Inc oligonucleotide mix
Oligonucleotide Mix, supplied by BioTeZ Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc05322337-164-43-49?v=BioTeZ+Inc
Average 90 stars, based on 1 article reviews
oligonucleotide mix - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Metabion International AG reverse oligonucleotide primer 5"- atcatggcaggtgaggatggact-3
Reverse Oligonucleotide Primer 5" Atcatggcaggtgaggatggact 3, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/pmc06182820-253-28-32?v=Metabion+International+AG
Average 90 stars, based on 1 article reviews
reverse oligonucleotide primer 5"- atcatggcaggtgaggatggact-3 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GeNOsys Inc oligonucleotide primers for reverse transcription of hprt mrna and subsequent pcr amplification of hprt cdna
Oligonucleotide Primers For Reverse Transcription Of Hprt Mrna And Subsequent Pcr Amplification Of Hprt Cdna, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/SNBoANq0q78SVuUxuVATpSwnlr6dvvTYqXuj702DM7hMwWu1gQuVpF3SyIrKZnWfEd2mwW8-55-4-19?v=GeNOsys+Inc
Average 90 stars, based on 1 article reviews
oligonucleotide primers for reverse transcription of hprt mrna and subsequent pcr amplification of hprt cdna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
TranScrip Partners reverse transcrip-tion using random oligonucleotide primers
Reverse Transcrip Tion Using Random Oligonucleotide Primers, supplied by TranScrip Partners, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+oligonucleotide+primer/pm18777249-24-89-86?v=TranScrip+Partners
Average 90 stars, based on 1 article reviews
reverse transcrip-tion using random oligonucleotide primers - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results